topA [2017-12-18 10:19:58]

DNA topoisomerase I

locus: BSU16120

pI: 9.02

mw: 78.89 kDa

protein length: 691 aa

gene length: 2073 bp

function: relaxation of negatively supercoiled DNA

product: DNA topoisomerase I

essential: yes

ec: 5.99.1.2

synonyms: topI

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
• [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.13|Quasi-essential genes]

Gene

Coordinates: 1,683,661 → 1,685,736

Phenotypes of a mutant

• essential [Pubmed|25092907], non-essential according to [Pubmed|28189581], but only one resistance cassette was possible

The protein

Catalyzed reaction/ biological activity

• relaxation of negatively supercoiled DNA

Protein family

• prokaryotic type I/III topoisomerase family (according to Swiss-Prot)

Paralogous protein(s)

• [protein|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|TopB]

[SW|Domains]

• N-terminal [SW|TOPRIM domain] (aa 3-114) [Pubmed|9722641]

Structure

• [PDB|2GAI] (from ''Thermotoga maritima '', 42% identity) [Pubmed|16600296]

additional information

• [protein|41199C76DF8CA804B7B8878D61228B9542A96AE4|TopA] may interact with [SW|RNA polymerase] [pubmed|21710567]
• mutations affecting Val-44 (V44D) and Ser-478 (S478P) result in TopA hyperactivity [pubmed|29242163]

Expression and Regulation

Operons

• genes: [gene|D72175937B3956C2BC500FC00CEC8EC57A0A76A8|sucC]-[gene|5900CAC1CE367F33B267673A7FC210A3A269B30E|sucD]-[gene|FC53216F600994C862F0C0D017C3FA28EB75DCB6|dprA]-[gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]
  description: [Pubmed|22383849]

  regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]

  regulation

  • repressed by glucose (2.4-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|12850135]
  • expression is heterogeneous [pubmed|29809139]

• genes: [gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]
  description: [Pubmed|22383849]

  additional information

  • [SW|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]

Biological materials

Mutant

• BKK16120 (Δ[gene|41199C76DF8CA804B7B8878D61228B9542A96AE4|topA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCCCCCTCAAGA, downstream forward: _UP4_TAGCGGTGAGCAGGGTCTTG

Expression vector

• pGP2060: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab

References

• 17114254,21710567,25092907,16600296,27378778,9722641,28189581,28414321,21710567,29242163